• About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us
AimactGrow
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
AimactGrow
No Result
View All Result

Tips on how to Create a Bioinformatics AI Agent Utilizing Biopython for DNA and Protein Evaluation

Admin by Admin
September 8, 2025
Home AI
Share on FacebookShare on Twitter


class BioPythonAIAgent:
   def __init__(self, e-mail="[email protected]"):
       self.e-mail = e-mail
       Entrez.e-mail = e-mail
       self.sequences = {}
       self.analysis_results = {}
       self.alignments = {}
       self.timber = {}
  
   def fetch_sequence_from_ncbi(self, accession_id, db="nucleotide", rettype="fasta"):
       strive:
           deal with = Entrez.efetch(db=db, id=accession_id, rettype=rettype, retmode="textual content")
           file = SeqIO.learn(deal with, "fasta")
           deal with.shut()
           self.sequences[accession_id] = file
           return file
       besides Exception as e:
           print(f"Error fetching sequence: {str(e)}")
           return None
  
   def create_sample_sequences(self):
       covid_spike = "MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT"
      
       human_insulin = "MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN"
      
       e_coli_16s = "AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTAAGGTTAATAACCTTGGCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACA"
      
       sample_sequences = [
           ("COVID_Spike", covid_spike, "SARS-CoV-2 Spike Protein"),
           ("Human_Insulin", human_insulin, "Human Insulin Precursor"),
           ("E_coli_16S", e_coli_16s, "E. coli 16S rRNA")
       ]
      
       for seq_id, seq_str, desc in sample_sequences:
           file = SeqRecord(Seq(seq_str), id=seq_id, description=desc)
           self.sequences[seq_id] = file
      
       return sample_sequences
  
   def analyze_sequence(self, sequence_id=None, sequence=None):
       if sequence_id and sequence_id in self.sequences:
           seq_record = self.sequences[sequence_id]
           seq = seq_record.seq
           description = seq_record.description
       elif sequence:
           seq = Seq(sequence)
           description = "Customized sequence"
       else:
           return None
      
       evaluation = {
           'size': len(seq),
           'composition': {}
       }
      
       for base in ['A', 'T', 'G', 'C']:
           evaluation['composition'][base] = seq.rely(base)
      
       if 'A' in evaluation['composition'] and 'T' in evaluation['composition']:
           evaluation['gc_content'] = spherical(gc_fraction(seq) * 100, 2)
           strive:
               evaluation['molecular_weight'] = spherical(molecular_weight(seq, seq_type="DNA"), 2)
           besides:
               evaluation['molecular_weight'] = len(seq) * 650
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               evaluation['translation'] = str(protein)
               evaluation['stop_codons'] = protein.rely('*')
              
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                   evaluation['protein_mw'] = spherical(prot_analysis.molecular_weight(), 2)
                   evaluation['isoelectric_point'] = spherical(prot_analysis.isoelectric_point(), 2)
                   evaluation['protein_composition'] = prot_analysis.get_amino_acids_percent()
       besides:
           go
      
       key = sequence_id if sequence_id else "customized"
       self.analysis_results[key] = evaluation
      
       return evaluation
  
   def visualize_composition(self, sequence_id):
       if sequence_id not in self.analysis_results:
           return
      
       evaluation = self.analysis_results[sequence_id]
      
       fig = make_subplots(
           rows=2, cols=2,
           specs=[[{"type": "pie"}, {"type": "bar"}],
                  [{"colspan": 2}, None]],
           subplot_titles=("Nucleotide Composition", "Base Rely", "Sequence Properties")
       )
      
       labels = record(evaluation['composition'].keys())
       values = record(evaluation['composition'].values())
      
       fig.add_trace(
           go.Pie(labels=labels, values=values, title="Composition"),
           row=1, col=1
       )
      
       fig.add_trace(
           go.Bar(x=labels, y=values, title="Rely", marker_color=['red', 'blue', 'green', 'orange']),
           row=1, col=2
       )
      
       properties = ['Length', 'GC%', 'MW (kDa)']
       prop_values = [
           analysis['length'],
           evaluation.get('gc_content', 0),
           evaluation.get('molecular_weight', 0) / 1000
       ]
      
       fig.add_trace(
           go.Scatter(x=properties, y=prop_values, mode="markers+traces",
                     marker=dict(dimension=10, colour="purple"), title="Properties"),
           row=2, col=1
       )
      
       fig.update_layout(
           title=f"Complete Evaluation: {sequence_id}",
           showlegend=False,
           top=600
       )
      
       fig.present()
  
   def perform_multiple_sequence_alignment(self, sequence_ids):
       if len(sequence_ids) < 2:
           return None
      
       sequences = []
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               sequences.append(self.sequences[seq_id])
      
       if len(sequences) < 2:
           return None
      
       from Bio.Align import PairwiseAligner
       aligner = PairwiseAligner()
       aligner.match_score = 2
       aligner.mismatch_score = -1
       aligner.open_gap_score = -2
       aligner.extend_gap_score = -0.5
      
       alignments = []
       for i in vary(len(sequences)):
           for j in vary(i+1, len(sequences)):
               alignment = aligner.align(sequences[i].seq, sequences[j].seq)[0]
               alignments.append(alignment)
      
       return alignments
  
   def create_phylogenetic_tree(self, alignment_key=None, sequences=None):
       if alignment_key and alignment_key in self.alignments:
           alignment = self.alignments[alignment_key]
       elif sequences:
           information = []
           for i, seq in enumerate(sequences):
               file = SeqRecord(Seq(seq), id=f"seq_{i}")
               information.append(file)
           SeqIO.write(information, "temp.fasta", "fasta")
          
           strive:
               clustalw_cline = ClustalwCommandline("clustalw2", infile="temp.fasta")
               stdout, stderr = clustalw_cline()
               alignment = AlignIO.learn("temp.aln", "clustal")
               os.take away("temp.fasta")
               os.take away("temp.aln")
               os.take away("temp.dnd")
           besides:
               return None
       else:
           return None
      
       calculator = DistanceCalculator('identification')
       dm = calculator.get_distance(alignment)
      
       constructor = DistanceTreeConstructor()
       tree = constructor.upgma(dm)
      
       tree_key = f"tree_{len(self.timber)}"
       self.timber[tree_key] = tree
      
       return tree
  
   def visualize_tree(self, tree):
       fig, ax = plt.subplots(figsize=(10, 6))
       Phylo.draw(tree, axes=ax)
       plt.title("Phylogenetic Tree")
       plt.tight_layout()
       plt.present()
  
   def protein_structure_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                  
                   structure_analysis = {
                       'molecular_weight': prot_analysis.molecular_weight(),
                       'isoelectric_point': prot_analysis.isoelectric_point(),
                       'amino_acid_percent': prot_analysis.get_amino_acids_percent(),
                       'secondary_structure': prot_analysis.secondary_structure_fraction(),
                       'flexibility': prot_analysis.flexibility(),
                       'gravy': prot_analysis.gravy()
                   }
                  
                   return structure_analysis
       besides:
           go
      
       return None
  
   def comparative_analysis(self, sequence_ids):
       outcomes = []
      
       for seq_id in sequence_ids:
           if seq_id in self.analysis_results:
               evaluation = self.analysis_results[seq_id].copy()
               evaluation['sequence_id'] = seq_id
               outcomes.append(evaluation)
      
       df = pd.DataFrame(outcomes)
      
       if len(df) > 1:
           fig = make_subplots(
               rows=2, cols=2,
               subplot_titles=("Size Comparability", "GC Content material", "Molecular Weight", "Composition Heatmap")
           )
          
           fig.add_trace(
               go.Bar(x=df['sequence_id'], y=df['length'], title="Size"),
               row=1, col=1
           )
          
           if 'gc_content' in df.columns:
               fig.add_trace(
                   go.Scatter(x=df['sequence_id'], y=df['gc_content'], mode="markers+traces", title="GC%"),
                   row=1, col=2
               )
          
           if 'molecular_weight' in df.columns:
               fig.add_trace(
                   go.Bar(x=df['sequence_id'], y=df['molecular_weight'], title="MW"),
                   row=2, col=1
               )
          
           fig.update_layout(title="Comparative Sequence Evaluation", top=600)
           fig.present()
      
       return df
  
   def codon_usage_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       if len(seq) % 3 != 0:
           return None
      
       codons = {}
       for i in vary(0, len(seq) - 2, 3):
           codon = str(seq[i:i+3])
           codons[codon] = codons.get(codon, 0) + 1
      
       codon_df = pd.DataFrame(record(codons.gadgets()), columns=['Codon', 'Count'])
       codon_df = codon_df.sort_values('Rely', ascending=False)
      
       fig = px.bar(codon_df.head(20), x='Codon', y='Rely',
                    title=f"High 20 Codon Utilization - {sequence_id}")
       fig.present()
      
       return codon_df
  
   def motif_search(self, sequence_id, motif_pattern):
       if sequence_id not in self.sequences:
           return []
      
       seq = str(self.sequences[sequence_id].seq)
       positions = []
      
       for i in vary(len(seq) - len(motif_pattern) + 1):
           if seq[i:i+len(motif_pattern)] == motif_pattern:
               positions.append(i)
      
       return positions
  
   def gc_content_window(self, sequence_id, window_size=100):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
       gc_values = []
       positions = []
      
       for i in vary(0, len(seq) - window_size + 1, window_size//4):
           window = seq[i:i+window_size]
           gc_values.append(gc_fraction(window) * 100)
           positions.append(i + window_size//2)
      
       fig = go.Determine()
       fig.add_trace(go.Scatter(x=positions, y=gc_values, mode="traces+markers",
                               title=f'GC Content material (window={window_size})'))
       fig.update_layout(
           title=f"GC Content material Sliding Window Evaluation - {sequence_id}",
           xaxis_title="Place",
           yaxis_title="GC Content material (%)"
       )
       fig.present()
      
       return positions, gc_values
  
   def run_comprehensive_analysis(self, sequence_ids):
       outcomes = {}
      
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               evaluation = self.analyze_sequence(seq_id)
               self.visualize_composition(seq_id)
              
               gc_analysis = self.gc_content_window(seq_id)
               codon_analysis = self.codon_usage_analysis(seq_id)
              
               outcomes[seq_id] = {
                   'basic_analysis': evaluation,
                   'gc_window': gc_analysis,
                   'codon_usage': codon_analysis
               }
      
       if len(sequence_ids) > 1:
           comparative_df = self.comparative_analysis(sequence_ids)
           outcomes['comparative'] = comparative_df
      
       return outcomes
Tags: AgentAnalysisBioinformaticsBiopythonCreateDNAProtein
Admin

Admin

Next Post
AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Recommended.

20 Greatest Search Engines In contrast

20 Greatest Search Engines In contrast

July 4, 2025
Sophos helps Goal-See Basis to advance macOS safety and inclusive cybersecurity schooling – Sophos Information

Sophos helps Goal-See Basis to advance macOS safety and inclusive cybersecurity schooling – Sophos Information

September 21, 2025

Trending.

10 tricks to begin getting ready! • Yoast

10 tricks to begin getting ready! • Yoast

July 21, 2025
AI-Assisted Menace Actor Compromises 600+ FortiGate Gadgets in 55 Nations

AI-Assisted Menace Actor Compromises 600+ FortiGate Gadgets in 55 Nations

February 23, 2026
Design Has By no means Been Extra Vital: Inside Shopify’s Acquisition of Molly

Design Has By no means Been Extra Vital: Inside Shopify’s Acquisition of Molly

September 8, 2025
Exporting a Material Simulation from Blender to an Interactive Three.js Scene

Exporting a Material Simulation from Blender to an Interactive Three.js Scene

August 20, 2025
Alibaba Workforce Open-Sources CoPaw: A Excessive-Efficiency Private Agent Workstation for Builders to Scale Multi-Channel AI Workflows and Reminiscence

Alibaba Workforce Open-Sources CoPaw: A Excessive-Efficiency Private Agent Workstation for Builders to Scale Multi-Channel AI Workflows and Reminiscence

March 1, 2026

AimactGrow

Welcome to AimactGrow, your ultimate source for all things technology! Our mission is to provide insightful, up-to-date content on the latest advancements in technology, coding, gaming, digital marketing, SEO, cybersecurity, and artificial intelligence (AI).

Categories

  • AI
  • Coding
  • Cybersecurity
  • Digital marketing
  • Gaming
  • SEO
  • Technology

Recent News

Instruments and the lengthy tail

“It’s quicker to simply do it myself”

March 14, 2026
At this time’s NYT Mini Crossword Solutions for June 21

At the moment’s NYT Mini Crossword Solutions for March 14

March 14, 2026
  • About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved

No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved