• About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us
AimactGrow
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
AimactGrow
No Result
View All Result

Tips on how to Create a Bioinformatics AI Agent Utilizing Biopython for DNA and Protein Evaluation

Admin by Admin
September 8, 2025
Home AI
Share on FacebookShare on Twitter


class BioPythonAIAgent:
   def __init__(self, e-mail="[email protected]"):
       self.e-mail = e-mail
       Entrez.e-mail = e-mail
       self.sequences = {}
       self.analysis_results = {}
       self.alignments = {}
       self.timber = {}
  
   def fetch_sequence_from_ncbi(self, accession_id, db="nucleotide", rettype="fasta"):
       strive:
           deal with = Entrez.efetch(db=db, id=accession_id, rettype=rettype, retmode="textual content")
           file = SeqIO.learn(deal with, "fasta")
           deal with.shut()
           self.sequences[accession_id] = file
           return file
       besides Exception as e:
           print(f"Error fetching sequence: {str(e)}")
           return None
  
   def create_sample_sequences(self):
       covid_spike = "MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT"
      
       human_insulin = "MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN"
      
       e_coli_16s = "AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTAAGGTTAATAACCTTGGCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACA"
      
       sample_sequences = [
           ("COVID_Spike", covid_spike, "SARS-CoV-2 Spike Protein"),
           ("Human_Insulin", human_insulin, "Human Insulin Precursor"),
           ("E_coli_16S", e_coli_16s, "E. coli 16S rRNA")
       ]
      
       for seq_id, seq_str, desc in sample_sequences:
           file = SeqRecord(Seq(seq_str), id=seq_id, description=desc)
           self.sequences[seq_id] = file
      
       return sample_sequences
  
   def analyze_sequence(self, sequence_id=None, sequence=None):
       if sequence_id and sequence_id in self.sequences:
           seq_record = self.sequences[sequence_id]
           seq = seq_record.seq
           description = seq_record.description
       elif sequence:
           seq = Seq(sequence)
           description = "Customized sequence"
       else:
           return None
      
       evaluation = {
           'size': len(seq),
           'composition': {}
       }
      
       for base in ['A', 'T', 'G', 'C']:
           evaluation['composition'][base] = seq.rely(base)
      
       if 'A' in evaluation['composition'] and 'T' in evaluation['composition']:
           evaluation['gc_content'] = spherical(gc_fraction(seq) * 100, 2)
           strive:
               evaluation['molecular_weight'] = spherical(molecular_weight(seq, seq_type="DNA"), 2)
           besides:
               evaluation['molecular_weight'] = len(seq) * 650
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               evaluation['translation'] = str(protein)
               evaluation['stop_codons'] = protein.rely('*')
              
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                   evaluation['protein_mw'] = spherical(prot_analysis.molecular_weight(), 2)
                   evaluation['isoelectric_point'] = spherical(prot_analysis.isoelectric_point(), 2)
                   evaluation['protein_composition'] = prot_analysis.get_amino_acids_percent()
       besides:
           go
      
       key = sequence_id if sequence_id else "customized"
       self.analysis_results[key] = evaluation
      
       return evaluation
  
   def visualize_composition(self, sequence_id):
       if sequence_id not in self.analysis_results:
           return
      
       evaluation = self.analysis_results[sequence_id]
      
       fig = make_subplots(
           rows=2, cols=2,
           specs=[[{"type": "pie"}, {"type": "bar"}],
                  [{"colspan": 2}, None]],
           subplot_titles=("Nucleotide Composition", "Base Rely", "Sequence Properties")
       )
      
       labels = record(evaluation['composition'].keys())
       values = record(evaluation['composition'].values())
      
       fig.add_trace(
           go.Pie(labels=labels, values=values, title="Composition"),
           row=1, col=1
       )
      
       fig.add_trace(
           go.Bar(x=labels, y=values, title="Rely", marker_color=['red', 'blue', 'green', 'orange']),
           row=1, col=2
       )
      
       properties = ['Length', 'GC%', 'MW (kDa)']
       prop_values = [
           analysis['length'],
           evaluation.get('gc_content', 0),
           evaluation.get('molecular_weight', 0) / 1000
       ]
      
       fig.add_trace(
           go.Scatter(x=properties, y=prop_values, mode="markers+traces",
                     marker=dict(dimension=10, colour="purple"), title="Properties"),
           row=2, col=1
       )
      
       fig.update_layout(
           title=f"Complete Evaluation: {sequence_id}",
           showlegend=False,
           top=600
       )
      
       fig.present()
  
   def perform_multiple_sequence_alignment(self, sequence_ids):
       if len(sequence_ids) < 2:
           return None
      
       sequences = []
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               sequences.append(self.sequences[seq_id])
      
       if len(sequences) < 2:
           return None
      
       from Bio.Align import PairwiseAligner
       aligner = PairwiseAligner()
       aligner.match_score = 2
       aligner.mismatch_score = -1
       aligner.open_gap_score = -2
       aligner.extend_gap_score = -0.5
      
       alignments = []
       for i in vary(len(sequences)):
           for j in vary(i+1, len(sequences)):
               alignment = aligner.align(sequences[i].seq, sequences[j].seq)[0]
               alignments.append(alignment)
      
       return alignments
  
   def create_phylogenetic_tree(self, alignment_key=None, sequences=None):
       if alignment_key and alignment_key in self.alignments:
           alignment = self.alignments[alignment_key]
       elif sequences:
           information = []
           for i, seq in enumerate(sequences):
               file = SeqRecord(Seq(seq), id=f"seq_{i}")
               information.append(file)
           SeqIO.write(information, "temp.fasta", "fasta")
          
           strive:
               clustalw_cline = ClustalwCommandline("clustalw2", infile="temp.fasta")
               stdout, stderr = clustalw_cline()
               alignment = AlignIO.learn("temp.aln", "clustal")
               os.take away("temp.fasta")
               os.take away("temp.aln")
               os.take away("temp.dnd")
           besides:
               return None
       else:
           return None
      
       calculator = DistanceCalculator('identification')
       dm = calculator.get_distance(alignment)
      
       constructor = DistanceTreeConstructor()
       tree = constructor.upgma(dm)
      
       tree_key = f"tree_{len(self.timber)}"
       self.timber[tree_key] = tree
      
       return tree
  
   def visualize_tree(self, tree):
       fig, ax = plt.subplots(figsize=(10, 6))
       Phylo.draw(tree, axes=ax)
       plt.title("Phylogenetic Tree")
       plt.tight_layout()
       plt.present()
  
   def protein_structure_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                  
                   structure_analysis = {
                       'molecular_weight': prot_analysis.molecular_weight(),
                       'isoelectric_point': prot_analysis.isoelectric_point(),
                       'amino_acid_percent': prot_analysis.get_amino_acids_percent(),
                       'secondary_structure': prot_analysis.secondary_structure_fraction(),
                       'flexibility': prot_analysis.flexibility(),
                       'gravy': prot_analysis.gravy()
                   }
                  
                   return structure_analysis
       besides:
           go
      
       return None
  
   def comparative_analysis(self, sequence_ids):
       outcomes = []
      
       for seq_id in sequence_ids:
           if seq_id in self.analysis_results:
               evaluation = self.analysis_results[seq_id].copy()
               evaluation['sequence_id'] = seq_id
               outcomes.append(evaluation)
      
       df = pd.DataFrame(outcomes)
      
       if len(df) > 1:
           fig = make_subplots(
               rows=2, cols=2,
               subplot_titles=("Size Comparability", "GC Content material", "Molecular Weight", "Composition Heatmap")
           )
          
           fig.add_trace(
               go.Bar(x=df['sequence_id'], y=df['length'], title="Size"),
               row=1, col=1
           )
          
           if 'gc_content' in df.columns:
               fig.add_trace(
                   go.Scatter(x=df['sequence_id'], y=df['gc_content'], mode="markers+traces", title="GC%"),
                   row=1, col=2
               )
          
           if 'molecular_weight' in df.columns:
               fig.add_trace(
                   go.Bar(x=df['sequence_id'], y=df['molecular_weight'], title="MW"),
                   row=2, col=1
               )
          
           fig.update_layout(title="Comparative Sequence Evaluation", top=600)
           fig.present()
      
       return df
  
   def codon_usage_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       if len(seq) % 3 != 0:
           return None
      
       codons = {}
       for i in vary(0, len(seq) - 2, 3):
           codon = str(seq[i:i+3])
           codons[codon] = codons.get(codon, 0) + 1
      
       codon_df = pd.DataFrame(record(codons.gadgets()), columns=['Codon', 'Count'])
       codon_df = codon_df.sort_values('Rely', ascending=False)
      
       fig = px.bar(codon_df.head(20), x='Codon', y='Rely',
                    title=f"High 20 Codon Utilization - {sequence_id}")
       fig.present()
      
       return codon_df
  
   def motif_search(self, sequence_id, motif_pattern):
       if sequence_id not in self.sequences:
           return []
      
       seq = str(self.sequences[sequence_id].seq)
       positions = []
      
       for i in vary(len(seq) - len(motif_pattern) + 1):
           if seq[i:i+len(motif_pattern)] == motif_pattern:
               positions.append(i)
      
       return positions
  
   def gc_content_window(self, sequence_id, window_size=100):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
       gc_values = []
       positions = []
      
       for i in vary(0, len(seq) - window_size + 1, window_size//4):
           window = seq[i:i+window_size]
           gc_values.append(gc_fraction(window) * 100)
           positions.append(i + window_size//2)
      
       fig = go.Determine()
       fig.add_trace(go.Scatter(x=positions, y=gc_values, mode="traces+markers",
                               title=f'GC Content material (window={window_size})'))
       fig.update_layout(
           title=f"GC Content material Sliding Window Evaluation - {sequence_id}",
           xaxis_title="Place",
           yaxis_title="GC Content material (%)"
       )
       fig.present()
      
       return positions, gc_values
  
   def run_comprehensive_analysis(self, sequence_ids):
       outcomes = {}
      
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               evaluation = self.analyze_sequence(seq_id)
               self.visualize_composition(seq_id)
              
               gc_analysis = self.gc_content_window(seq_id)
               codon_analysis = self.codon_usage_analysis(seq_id)
              
               outcomes[seq_id] = {
                   'basic_analysis': evaluation,
                   'gc_window': gc_analysis,
                   'codon_usage': codon_analysis
               }
      
       if len(sequence_ids) > 1:
           comparative_df = self.comparative_analysis(sequence_ids)
           outcomes['comparative'] = comparative_df
      
       return outcomes
Tags: AgentAnalysisBioinformaticsBiopythonCreateDNAProtein
Admin

Admin

Next Post
AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Recommended.

5 greatest CRMs for name middle companies in 2025

5 greatest CRMs for name middle companies in 2025

July 27, 2025
Planet Know-how Industrial Swap Flaws Threat Full Takeover

Planet Know-how Industrial Swap Flaws Threat Full Takeover

April 27, 2025

Trending.

The way to Clear up the Wall Puzzle in The place Winds Meet

The way to Clear up the Wall Puzzle in The place Winds Meet

November 16, 2025
Mistral AI Releases Voxtral TTS: A 4B Open-Weight Streaming Speech Mannequin for Low-Latency Multilingual Voice Era

Mistral AI Releases Voxtral TTS: A 4B Open-Weight Streaming Speech Mannequin for Low-Latency Multilingual Voice Era

March 29, 2026
Google Introduces Simula: A Reasoning-First Framework for Producing Controllable, Scalable Artificial Datasets Throughout Specialised AI Domains

Google Introduces Simula: A Reasoning-First Framework for Producing Controllable, Scalable Artificial Datasets Throughout Specialised AI Domains

April 21, 2026
Google DeepMind Introduces Decoupled DiLoCo: An Asynchronous Coaching Structure Reaching 88% Goodput Below Excessive {Hardware} Failure Charges

Google DeepMind Introduces Decoupled DiLoCo: An Asynchronous Coaching Structure Reaching 88% Goodput Below Excessive {Hardware} Failure Charges

April 24, 2026
5 AI Compute Architectures Each Engineer Ought to Know: CPUs, GPUs, TPUs, NPUs, and LPUs In contrast

5 AI Compute Architectures Each Engineer Ought to Know: CPUs, GPUs, TPUs, NPUs, and LPUs In contrast

April 10, 2026

AimactGrow

Welcome to AimactGrow, your ultimate source for all things technology! Our mission is to provide insightful, up-to-date content on the latest advancements in technology, coding, gaming, digital marketing, SEO, cybersecurity, and artificial intelligence (AI).

Categories

  • AI
  • Coding
  • Cybersecurity
  • Digital marketing
  • Gaming
  • SEO
  • Technology

Recent News

The place is your N + 1?

Puddles | Seth’s Weblog

April 28, 2026
Dell XPS 16 Assessment: Properly-Rounded, Massive-Display Laptop computer With Spiky, Massive-Time Value

Dell XPS 16 Assessment: Properly-Rounded, Massive-Display Laptop computer With Spiky, Massive-Time Value

April 28, 2026
  • About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved

No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved