• About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us
AimactGrow
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing
No Result
View All Result
AimactGrow
No Result
View All Result

Tips on how to Create a Bioinformatics AI Agent Utilizing Biopython for DNA and Protein Evaluation

Admin by Admin
September 8, 2025
Home AI
Share on FacebookShare on Twitter


class BioPythonAIAgent:
   def __init__(self, e-mail="[email protected]"):
       self.e-mail = e-mail
       Entrez.e-mail = e-mail
       self.sequences = {}
       self.analysis_results = {}
       self.alignments = {}
       self.timber = {}
  
   def fetch_sequence_from_ncbi(self, accession_id, db="nucleotide", rettype="fasta"):
       strive:
           deal with = Entrez.efetch(db=db, id=accession_id, rettype=rettype, retmode="textual content")
           file = SeqIO.learn(deal with, "fasta")
           deal with.shut()
           self.sequences[accession_id] = file
           return file
       besides Exception as e:
           print(f"Error fetching sequence: {str(e)}")
           return None
  
   def create_sample_sequences(self):
       covid_spike = "MFVFLVLLPLVSSQCVNLTTRTQLPPAYTNSFTRGVYYPDKVFRSSVLHSTQDLFLPFFSNVTWFHAIHVSGTNGTKRFDNPVLPFNDGVYFASTEKSNIIRGWIFGTTLDSKTQSLLIVNNATNVVIKVCEFQFCNDPFLGVYYHKNNKSWMESEFRVYSSANNCTFEYVSQPFLMDLEGKQGNFKNLREFVFKNIDGYFKIYSKHTPINLVRDLPQGFSALEPLVDLPIGINITRFQTLLALHRSYLTPGDSSSGWTAGAAAYYVGYLQPRTFLLKYNENGTITDAVDCALDPLSETKCTLKSFTVEKGIYQTSNFRVQPTESIVRFPNITNLCPFGEVFNATRFASVYAWNRKRISNCVADYSVLYNSASFSTFKCYGVSPTKLNDLCFTNVYADSFVIRGDEVRQIAPGQTGKIADYNYKLPDDFTGCVIAWNSNNLDSKVGGNYNYLYRLFRKSNLKPFERDISTEIYQAGSTPCNGVEGFNCYFPLQSYGFQPTNGVGYQPYRVVVLSFELLHAPATVCGPKKSTNLVKNKCVNFNFNGLTGTGVLTESNKKFLPFQQFGRDIADTTDAVRDPQTLEILDITPCSFGGVSVITPGTNTSNQVAVLYQDVNCTEVPVAIHADQLTPTWRVYSTGSNVFQTRAGCLIGAEHVNNSYECDIPIGAGICASYQTQTNSPRRARSVASQSIIAYTMSLGAENSVAYSNNSIAIPTNFTISVTTEILPVSMTKTSVDCTMYICGDSTECSNLLLQYGSFCTQLNRALTGIAVEQDKNTQEVFAQVKQIYKTPPIKDFGGFNFSQILPDPSKPSKRSFIEDLLFNKVTLADAGFIKQYGDCLGDIAARDLICAQKFNGLTVLPPLLTDEMIAQYTSALLAGTITSGWTFGAGAALQIPFAMQMAYRFNGIGVTQNVLYENQKLIANQFNSAIGKIQDSLSSTASALGKLQDVVNQNAQALNTLVKQLSSNFGAISSVLNDILSRLDKVEAEVQIDRLITGRLQSLQTYVTQQLIRAAEIRASANLAATKMSECVLGQSKRVDFCGKGYHLMSFPQSAPHGVVFLHVTYVPAQEKNFTTAPAICHDGKAHFPREGVFVSNGTHWFVTQRNFYEPQIITTDNTFVSGNCDVVIGIVNNTVYDPLQPELDSFKEELDKYFKNHTSPDVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQYIKWPWYIWLGFIAGLIAIVMVTIMLCCMTSCCSCLKGCCSCGSCCKFDEDDSEPVLKGVKLHYT"
      
       human_insulin = "MALWMRLLPLLALLALWGPDPAAAFVNQHLCGSHLVEALYLVCGERGFFYTPKTRREAEDLQVGQVELGGGPGAGSLQPLALEGSLQKRGIVEQCCTSICSLYQLENYCN"
      
       e_coli_16s = "AAATTGAAGAGTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAAGTCGAACGGTAACAGGAAGCAGCTTGCTGCTTTGCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAATGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGCGTTAAGGTTAATAACCTTGGCGATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACA"
      
       sample_sequences = [
           ("COVID_Spike", covid_spike, "SARS-CoV-2 Spike Protein"),
           ("Human_Insulin", human_insulin, "Human Insulin Precursor"),
           ("E_coli_16S", e_coli_16s, "E. coli 16S rRNA")
       ]
      
       for seq_id, seq_str, desc in sample_sequences:
           file = SeqRecord(Seq(seq_str), id=seq_id, description=desc)
           self.sequences[seq_id] = file
      
       return sample_sequences
  
   def analyze_sequence(self, sequence_id=None, sequence=None):
       if sequence_id and sequence_id in self.sequences:
           seq_record = self.sequences[sequence_id]
           seq = seq_record.seq
           description = seq_record.description
       elif sequence:
           seq = Seq(sequence)
           description = "Customized sequence"
       else:
           return None
      
       evaluation = {
           'size': len(seq),
           'composition': {}
       }
      
       for base in ['A', 'T', 'G', 'C']:
           evaluation['composition'][base] = seq.rely(base)
      
       if 'A' in evaluation['composition'] and 'T' in evaluation['composition']:
           evaluation['gc_content'] = spherical(gc_fraction(seq) * 100, 2)
           strive:
               evaluation['molecular_weight'] = spherical(molecular_weight(seq, seq_type="DNA"), 2)
           besides:
               evaluation['molecular_weight'] = len(seq) * 650
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               evaluation['translation'] = str(protein)
               evaluation['stop_codons'] = protein.rely('*')
              
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                   evaluation['protein_mw'] = spherical(prot_analysis.molecular_weight(), 2)
                   evaluation['isoelectric_point'] = spherical(prot_analysis.isoelectric_point(), 2)
                   evaluation['protein_composition'] = prot_analysis.get_amino_acids_percent()
       besides:
           go
      
       key = sequence_id if sequence_id else "customized"
       self.analysis_results[key] = evaluation
      
       return evaluation
  
   def visualize_composition(self, sequence_id):
       if sequence_id not in self.analysis_results:
           return
      
       evaluation = self.analysis_results[sequence_id]
      
       fig = make_subplots(
           rows=2, cols=2,
           specs=[[{"type": "pie"}, {"type": "bar"}],
                  [{"colspan": 2}, None]],
           subplot_titles=("Nucleotide Composition", "Base Rely", "Sequence Properties")
       )
      
       labels = record(evaluation['composition'].keys())
       values = record(evaluation['composition'].values())
      
       fig.add_trace(
           go.Pie(labels=labels, values=values, title="Composition"),
           row=1, col=1
       )
      
       fig.add_trace(
           go.Bar(x=labels, y=values, title="Rely", marker_color=['red', 'blue', 'green', 'orange']),
           row=1, col=2
       )
      
       properties = ['Length', 'GC%', 'MW (kDa)']
       prop_values = [
           analysis['length'],
           evaluation.get('gc_content', 0),
           evaluation.get('molecular_weight', 0) / 1000
       ]
      
       fig.add_trace(
           go.Scatter(x=properties, y=prop_values, mode="markers+traces",
                     marker=dict(dimension=10, colour="purple"), title="Properties"),
           row=2, col=1
       )
      
       fig.update_layout(
           title=f"Complete Evaluation: {sequence_id}",
           showlegend=False,
           top=600
       )
      
       fig.present()
  
   def perform_multiple_sequence_alignment(self, sequence_ids):
       if len(sequence_ids) < 2:
           return None
      
       sequences = []
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               sequences.append(self.sequences[seq_id])
      
       if len(sequences) < 2:
           return None
      
       from Bio.Align import PairwiseAligner
       aligner = PairwiseAligner()
       aligner.match_score = 2
       aligner.mismatch_score = -1
       aligner.open_gap_score = -2
       aligner.extend_gap_score = -0.5
      
       alignments = []
       for i in vary(len(sequences)):
           for j in vary(i+1, len(sequences)):
               alignment = aligner.align(sequences[i].seq, sequences[j].seq)[0]
               alignments.append(alignment)
      
       return alignments
  
   def create_phylogenetic_tree(self, alignment_key=None, sequences=None):
       if alignment_key and alignment_key in self.alignments:
           alignment = self.alignments[alignment_key]
       elif sequences:
           information = []
           for i, seq in enumerate(sequences):
               file = SeqRecord(Seq(seq), id=f"seq_{i}")
               information.append(file)
           SeqIO.write(information, "temp.fasta", "fasta")
          
           strive:
               clustalw_cline = ClustalwCommandline("clustalw2", infile="temp.fasta")
               stdout, stderr = clustalw_cline()
               alignment = AlignIO.learn("temp.aln", "clustal")
               os.take away("temp.fasta")
               os.take away("temp.aln")
               os.take away("temp.dnd")
           besides:
               return None
       else:
           return None
      
       calculator = DistanceCalculator('identification')
       dm = calculator.get_distance(alignment)
      
       constructor = DistanceTreeConstructor()
       tree = constructor.upgma(dm)
      
       tree_key = f"tree_{len(self.timber)}"
       self.timber[tree_key] = tree
      
       return tree
  
   def visualize_tree(self, tree):
       fig, ax = plt.subplots(figsize=(10, 6))
       Phylo.draw(tree, axes=ax)
       plt.title("Phylogenetic Tree")
       plt.tight_layout()
       plt.present()
  
   def protein_structure_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       strive:
           if len(seq) % 3 == 0:
               protein = seq.translate()
               if '*' not in str(protein)[:-1]:
                   prot_analysis = ProteinAnalysis(str(protein)[:-1])
                  
                   structure_analysis = {
                       'molecular_weight': prot_analysis.molecular_weight(),
                       'isoelectric_point': prot_analysis.isoelectric_point(),
                       'amino_acid_percent': prot_analysis.get_amino_acids_percent(),
                       'secondary_structure': prot_analysis.secondary_structure_fraction(),
                       'flexibility': prot_analysis.flexibility(),
                       'gravy': prot_analysis.gravy()
                   }
                  
                   return structure_analysis
       besides:
           go
      
       return None
  
   def comparative_analysis(self, sequence_ids):
       outcomes = []
      
       for seq_id in sequence_ids:
           if seq_id in self.analysis_results:
               evaluation = self.analysis_results[seq_id].copy()
               evaluation['sequence_id'] = seq_id
               outcomes.append(evaluation)
      
       df = pd.DataFrame(outcomes)
      
       if len(df) > 1:
           fig = make_subplots(
               rows=2, cols=2,
               subplot_titles=("Size Comparability", "GC Content material", "Molecular Weight", "Composition Heatmap")
           )
          
           fig.add_trace(
               go.Bar(x=df['sequence_id'], y=df['length'], title="Size"),
               row=1, col=1
           )
          
           if 'gc_content' in df.columns:
               fig.add_trace(
                   go.Scatter(x=df['sequence_id'], y=df['gc_content'], mode="markers+traces", title="GC%"),
                   row=1, col=2
               )
          
           if 'molecular_weight' in df.columns:
               fig.add_trace(
                   go.Bar(x=df['sequence_id'], y=df['molecular_weight'], title="MW"),
                   row=2, col=1
               )
          
           fig.update_layout(title="Comparative Sequence Evaluation", top=600)
           fig.present()
      
       return df
  
   def codon_usage_analysis(self, sequence_id):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
      
       if len(seq) % 3 != 0:
           return None
      
       codons = {}
       for i in vary(0, len(seq) - 2, 3):
           codon = str(seq[i:i+3])
           codons[codon] = codons.get(codon, 0) + 1
      
       codon_df = pd.DataFrame(record(codons.gadgets()), columns=['Codon', 'Count'])
       codon_df = codon_df.sort_values('Rely', ascending=False)
      
       fig = px.bar(codon_df.head(20), x='Codon', y='Rely',
                    title=f"High 20 Codon Utilization - {sequence_id}")
       fig.present()
      
       return codon_df
  
   def motif_search(self, sequence_id, motif_pattern):
       if sequence_id not in self.sequences:
           return []
      
       seq = str(self.sequences[sequence_id].seq)
       positions = []
      
       for i in vary(len(seq) - len(motif_pattern) + 1):
           if seq[i:i+len(motif_pattern)] == motif_pattern:
               positions.append(i)
      
       return positions
  
   def gc_content_window(self, sequence_id, window_size=100):
       if sequence_id not in self.sequences:
           return None
      
       seq = self.sequences[sequence_id].seq
       gc_values = []
       positions = []
      
       for i in vary(0, len(seq) - window_size + 1, window_size//4):
           window = seq[i:i+window_size]
           gc_values.append(gc_fraction(window) * 100)
           positions.append(i + window_size//2)
      
       fig = go.Determine()
       fig.add_trace(go.Scatter(x=positions, y=gc_values, mode="traces+markers",
                               title=f'GC Content material (window={window_size})'))
       fig.update_layout(
           title=f"GC Content material Sliding Window Evaluation - {sequence_id}",
           xaxis_title="Place",
           yaxis_title="GC Content material (%)"
       )
       fig.present()
      
       return positions, gc_values
  
   def run_comprehensive_analysis(self, sequence_ids):
       outcomes = {}
      
       for seq_id in sequence_ids:
           if seq_id in self.sequences:
               evaluation = self.analyze_sequence(seq_id)
               self.visualize_composition(seq_id)
              
               gc_analysis = self.gc_content_window(seq_id)
               codon_analysis = self.codon_usage_analysis(seq_id)
              
               outcomes[seq_id] = {
                   'basic_analysis': evaluation,
                   'gc_window': gc_analysis,
                   'codon_usage': codon_analysis
               }
      
       if len(sequence_ids) > 1:
           comparative_df = self.comparative_analysis(sequence_ids)
           outcomes['comparative'] = comparative_df
      
       return outcomes
Tags: AgentAnalysisBioinformaticsBiopythonCreateDNAProtein
Admin

Admin

Next Post
AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

AI Search Sends Customers to 404 Pages Almost 3X Extra Than Google

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Recommended.

Instruments and the lengthy tail

Two helpful AI ways

October 13, 2025
Disney and Common sue Midjourney over copyright

Disney and Common sue Midjourney over copyright

June 12, 2025

Trending.

Backrooms director Kane Parsons explains the birds, the portals, and his sensible results

Backrooms director Kane Parsons explains the birds, the portals, and his sensible results

May 31, 2026
100 Most Costly Key phrases for Google Advertisements in 2026

100 Most Costly Key phrases for Google Advertisements in 2026

January 13, 2026
Resident Evil followers have adopted a Love & Deepspace character because the son of Leon S. Kennedy and one in every of his potential spouses

Resident Evil followers have adopted a Love & Deepspace character because the son of Leon S. Kennedy and one in every of his potential spouses

April 4, 2026
AI & data-driven Starbucks – Deep Brew

AI & data-driven Starbucks – Deep Brew

May 18, 2026
Nsfw Chatgpt Options – Examples I’ve Used

Nsfw Chatgpt Options – Examples I’ve Used

October 13, 2025

AimactGrow

Welcome to AimactGrow, your ultimate source for all things technology! Our mission is to provide insightful, up-to-date content on the latest advancements in technology, coding, gaming, digital marketing, SEO, cybersecurity, and artificial intelligence (AI).

Categories

  • AI
  • Coding
  • Cybersecurity
  • Digital marketing
  • Gaming
  • SEO
  • Technology

Recent News

Safety Threat Advisors Named a Finalist in CRN’s 2026 Better of the Channel Awards

July 27, 2026
Google Doesn’t Punish AI Content material; It Punishes Unhealthy Content material (331k Pages Studied)

Google Doesn’t Punish AI Content material; It Punishes Unhealthy Content material (331k Pages Studied)

July 27, 2026
  • About Us
  • Privacy Policy
  • Disclaimer
  • Contact Us

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved

No Result
View All Result
  • Home
  • Technology
  • AI
  • SEO
  • Coding
  • Gaming
  • Cybersecurity
  • Digital marketing

© 2025 https://blog.aimactgrow.com/ - All Rights Reserved